86
|
Sangon Biotech
ctaatgggaacgtcacacacca sangon biotech n a tnfa primer Ctaatgggaacgtcacacacca Sangon Biotech N A Tnfa Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+ctaatgggaacgtcacacacca+n+primer+sangon+tnfa/pm38159573-806-207-208 Average 86 stars, based on 1 article reviews
ctaatgggaacgtcacacacca sangon biotech n a tnfa primer - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
ggcttctttcgcacaatctcaat sangon biotech n a pdgfra primer Ggcttctttcgcacaatctcaat Sangon Biotech N A Pdgfra Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+ggcttctttcgcacaatctcaat+n+pdgfra+primer+sangon/pm35863346-241-84-85 Average 86 stars, based on 1 article reviews
ggcttctttcgcacaatctcaat sangon biotech n a pdgfra primer - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
cagggtcaaggcaagcctc sangon biotech n a cxcl5 primer Cagggtcaaggcaagcctc Sangon Biotech N A Cxcl5 Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+cagggtcaaggcaagcctc+cxcl5+n+primer+sangon/pm38159573-806-235-236 Average 86 stars, based on 1 article reviews
cagggtcaaggcaagcctc sangon biotech n a cxcl5 primer - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
accttccaggatgaggacatga sangon biotech n a il1b primer Accttccaggatgaggacatga Sangon Biotech N A Il1b Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sangon+biotech+n+a+primer/a+accttccaggatgaggacatga+biotech+il1b+n+primer+sangon/pm38159573-806-200-201 Average 86 stars, based on 1 article reviews
accttccaggatgaggacatga sangon biotech n a il1b primer - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
sangon biotech n a primer Sangon Biotech N A Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+n+primer+sangon/pm41534530-729-51-52 Average 86 stars, based on 1 article reviews
sangon biotech n a primer - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
gcgagtgcattccgctta sangon biotech n a gapdh primer Gcgagtgcattccgctta Sangon Biotech N A Gapdh Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sangon+biotech+n+a+primer/a+aggtcggtgtgaacggatttg+biotech+gapdh+n+primer+sangon/pm38159573-806-249-250 Average 86 stars, based on 1 article reviews
gcgagtgcattccgctta sangon biotech n a gapdh primer - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
amplicon pcr reverse primer Amplicon Pcr Reverse Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pmc12536269-84-20-29 Average 86 stars, based on 1 article reviews
amplicon pcr reverse primer - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
short hairpin rna shrna transfection shrna Short Hairpin Rna Shrna Transfection Shrna, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+forward+ggacagagagaaaggaataaacaacc+n+primer+sangon+usp15/pm41922122-335-4-13 Average 86 stars, based on 1 article reviews
short hairpin rna shrna transfection shrna - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
tcatctttcaacacgcaggacagg sangon biotech n a primers Tcatctttcaacacgcaggacagg Sangon Biotech N A Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+n+primers+sangon+tcatctttcaacacgcaggacagg/pm41385364-353-78-79 Average 86 stars, based on 1 article reviews
tcatctttcaacacgcaggacagg sangon biotech n a primers - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
gcagaggtaaggtgaccatctc sangon biotech n a primers Gcagaggtaaggtgaccatctc Sangon Biotech N A Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+gcagaggtaaggtgaccatctc+n+primers+sangon/pm41385364-353-177-178 Average 86 stars, based on 1 article reviews
gcagaggtaaggtgaccatctc sangon biotech n a primers - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
acggctggaggtctgtcaagg sangon biotech n a primers Acggctggaggtctgtcaagg Sangon Biotech N A Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sangon+biotech+n+a+primer/a+acggctggaggtctgtcaagg+biotech+n+primers+sangon/pm41385364-353-133-134 Average 86 stars, based on 1 article reviews
acggctggaggtctgtcaagg sangon biotech n a primers - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
gtggtgttgaggttgcggtctg sangon biotech n a primers Gtggtgttgaggttgcggtctg Sangon Biotech N A Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+gtggtgttgaggttgcggtctg+n+primers+sangon/pm41385364-353-144-145 Average 86 stars, based on 1 article reviews
gtggtgttgaggttgcggtctg sangon biotech n a primers - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |